Nucleic acid - PDFSEARCH.IO - Document Search Engine

Nucleic acid
Results: 1704

#	Item
191	Cell, Vol. 97, 491–502, May 14, 1999, Copyright 1999 by Cell Press A Detailed View of a Ribosomal Active Site: The Structure of the L11–RNA Complex Brian T. Wimberly,* Rebecca Guymon,* John P. McCutcheon,* Stephe Add to Reading List Source URL: www.mrc-lmb.cam.ac.uk Language: English - Date: 2007-05-08 05:11:21 Nucleic acid tertiary structure Gene expression LSm Transcription Hammerhead ribozyme Stem-loop Ribozyme Signal recognition particle RNA Biomolecular structure RNA Genetics Biology
192	Organization Genetic Disorders FDA-Approved CE Marked Certified & Standardized Reference Materials Add to Reading List Source URL: wwwn.cdc.gov Language: English - Date: 2013-06-20 10:04:04 Chemistry Molecular biology Polymerase chain reaction Amplifiers Genetics Nucleic acid test Nucleic acid Multiplex Real-time polymerase chain reaction Biology Laboratory techniques Science
193	Downloaded from rsif.royalsocietypublishing.org on January 29, 2014 Computer-assisted design for scaling up systems based on DNA reaction networks rsif.royalsocietypublishing.org Add to Reading List Source URL: www.dna.caltech.edu Language: English - Date: 2014-01-30 00:17:24 Genetics Helices Catalysis Gene expression Sense Gene Enzyme Nucleic acid double helix Biology Molecular biology DNA
194	Pure & Appl. Chem., Vol. 70, No. 1, pp, 1998. Printed in Great BritainIUPAC INTERNATIONAL UNION OF PURE AND APPLIED CHEMISTRY Add to Reading List Source URL: old.iupac.org Language: English - Date: 2004-06-03 11:49:39 Nuclear magnetic resonance spectroscopy Chemical nomenclature Proton NMR Hydrogen bond Topicity Amino acid Nucleic acid Cycloalkane Intrinsically unstructured proteins Chemistry Nuclear magnetic resonance Spectroscopy
195	Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:23 Genetics DNA Biotechnology Base pair Nucleic acid sequence Complementarity Pyrosequencing Polymerase chain reaction 454 Life Sciences Biology Molecular biology DNA sequencing
196	Journal of Biotechnology–193 Classification of hyper-variable Corynebacterium glutamicum surface-layer proteins by sequence analyses and atomic force microscopy Nicole Hansmeier a,b , Frank W. Bartels c Add to Reading List Source URL: roslab.physics.asu.edu Language: English - Date: 2010-01-04 11:29:44 Protein biosynthesis Corynebacterineae Molecular biology Corynebacterium Gram-positive bacteria Nucleic acid sequence Genetic code Translation Hox gene Biology Biochemistry Gene expression
197	Talk . Single-molecule manipulation of RNA structures: double-stranded helices and G-quadruplexes J. Ricardo Arias-Gonzalez IMDEA Nanociencia Add to Reading List Source URL: www.nanobioviews.net Language: English - Date: 2013-06-10 17:35:29 DNA G-quadruplex Molecular genetics Molecular biology Virus Optical tweezers Nucleic acid Telomere Single-molecule experiment Biology Genetics RNA
198	MOLECULAR BIOLOGY GRADE AGAROSE FREE FLUORESCENT RULER OR TIMER: • • • • Add to Reading List Source URL: scientifix.com.au Language: English Molecular biology Ethidium bromide Fluorescence Staining Nucleic acid Gel electrophoresis Fluorescence in the life sciences Chemistry Biology Staining dyes
199	Talk . Energy landscape analysis of biomolecular folding: pathways, rates and transition times Michael Woodside Department of Physics, University of Alberta, and Add to Reading List Source URL: www.nanobioviews.net Language: English - Date: 2013-06-07 12:14:00 Genetics Energy landscape Physics Protein Nanotechnology Nucleic acid Biology Proteins Proteomics
200	Nucleic Acids Research Advance Access published December 8, 2006 Nucleic Acids Research, 2006, Vol. 00, No. 00 1–10 doi:nar/gkl483 Recharacterization of ancient DNA miscoding lesions: insights in the era of seq Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:22 Molecular biology DNA repair Nucleic acid sequence Polymerase chain reaction Deamination RNA Sticky and blunt ends Nuclease Nucleic acid Biology Genetics DNA

UPDATE